Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB37YM15FM1
Length(NT) : 659
Best Gene Model Blast : Link to GSTUMT00007652001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG04110.1
Accession: ref|XP_384286.1| Score: 355 E_value: 4e-32
KEGG Definition: hypothetical protein
Accession: fgr:FG04110.1 Score: 355 E_value: 2e-32
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB37YM15FM1
TTGGAAGACTTTCGCTTCTTATTTTATTTGCCGAGTTCCCTTCCATCTAT
TGTTTCGATTCTCTCCACCCAGACCAGCCCCCCTACCCCTGAGAAAATCT
AACCTAGCCGTCTAAGAGGGTATGGTGCATTGCGATATCACTGCGAAAAT
AGGATAAAACGATAACGACGCCTACGCTTGCGGTACTTTGATTGGAAATT
TCCTCTTGCACTCCTTCGCCTTTACACCGCCATACACGGCGAGATCATGT
CGCTGAATGGACTAGATTCCCCACAATTGACAGAATCTTTTGACAAGGCA
TGTGCTGAGCCTGGTGGATGGTTCTGGATCAAATACACTTCCCGGGATGA
TGTCGAATTCTTGTGTCGCGGGAGCAACGGGTCAGAGGGGATGAGAGAAG
CTGCTGCGAAGGAGCCTAACGATTCACCATTGTACGGATTCATAAGGTTC
AGACGGAGAAATATTTTAATCAAGTACATTCCCGAAGAAACATCAAGGGT
TCTAAAAGCTCGATCAGTGGTGCACTTCCAATCTATTGTGGAACGGTTCA
ACCCGCACGACACTGAAATTACAATTACTTGTCCCAAGGAGCTTCGTGAC
CATGCACTGACCTCGGCATGTTCTACCCATACCGCCACTGCCTCTATTTC
CTCCTCAAA

Sequences in the Contig:

SY0AAB37YM15FM1