Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB37YJ01FM1
Length(NT) : 530
Best Gene Model Blast : Link to GSTUMT00008603001 E-value : 1e-142
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE56465.1| Score: 251 E_value: 3e-20
KEGG Definition: predicted protein
Accession: aor:AO090005001557 Score: 251 E_value: 1e-20
KOG Definition: No Hit Found
PFAM Definition: DUF1748, Fungal protein of unknown function (DUF1748). This is a family of fungal proteins of unknown function..
Pfam Number: pfam08520 Score: 255 E_value: 3e-23
Swissprot: Q10167|YAUE_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>SY0AAB37YJ01FM1
TTGGGAACCTACAATCCAACCATCCTTTTCCACCCTTCATCACCAACCGA
ACCGGTAGAAATCCGCAGCCATACTCCTCTTTCTACTACCCTGTTTTATC
TCCCTGCCACTCAATATGCTCGGCAAAATCGCCCACTACAGCTTTGACGC
AATCTTATTCTCCGCCTTTCTAGCAGGCGTTAAGCGGTCCACCGGTCTCA
CAGTCTCCTCTTTCCAAACCGAGAAGATTGAATCCAAAGACGTCCGCTCC
GCAATCGACAAATACCTCAACATTGGAGAATGGTTTATGGATCAGAGCAT
TGCCGCGATGGGCAGCAGCAATTACTTTGAGAGGAGACGATAATCTACTC
ATTCCTTTACGGCGGGGGGGTTCACGAATGATGATTGGATGGTTTTCTCC
TGTTCGACAAAAAAAGAAAAAAAGAAAACCCGTATGAAAATAAATAAAAG
TTCGGTGGATGTCCTGGGAAGGAAAAACGATTCGATGACTATATACTGGG
TTTGGATCATTGGGTCGGTTTCACGTTCTT

Sequences in the Contig:

SY0AAB37YJ01FM1