Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB37YH22FM1
Length(NT) : 657
Best Gene Model Blast : Link to GSTUMT00006707001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_03401
Accession: ref|XP_001243960.1| Score: 158 E_value: 3e-11
KEGG Definition: hypothetical protein [EC:2.7.11.22]; K07760 cyclin-dependent kinase
Accession: ani:AN0699.2 Score: 144 E_value: 1e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB37YH22FM1
TTGGAAATAACATCACGACACAATCATGCATGGTTTCGCTTCAAATAATT
TTTCCTAGGAGGGAGAATTTTTTGGCTCACATGGCCATCGTAGAGCCTCA
TTATTGGAGTCGTCCGATCCGAGCCTCGAGCACTCTCGTGCTCTATCCTC
CGCCCGAGCTATCGAAGTCGAGTCCCACGAGAAGTCTTTCTCACAGGAGG
AATACACCCGCCTTTGGAAGGCCAAACTACAAGAGCTTAAGGAGAAATAT
GCAGAGAAGCAGCTGGAGACTCGAAGTCTCTCTGCAGTTTCGGGATCCGG
CAGTGCTTTCGATGATGCTGCTTCCCAGGACATCCCGCACGCAACAGATA
GGGGAATCACAATTGGCCGCTTCATTGGCTGCAGACATCACAACTCGGGG
ATCTTCTCGGACGTCTATAAAGCTCTATTAAAGCCCATGACTCTCATGGT
CGCCCGCTCAATTCGTCGCCTTGAAAGTCACTATCCCTTCTAGAATGGCC
CCACCGCACGACTCCCACCGTGAGGCCAGAATTCTTCAAAAATCCGAGCA
CAGATGCGTCGTCAAGCTCCTCGAGAAATTTACGCTGCCGACATCTCAAT
TCGTCATGGTGTTTCCTTTCTACAACTATAGCCTCGACACACTCCTCAAG
TCAAATG

Sequences in the Contig:

SY0AAB37YH22FM1