Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB37YG18FM1
Length(NT) : 435
Best Gene Model Blast : Link to GSTUMT00007812001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001217451.1| Score: 395 E_value: 4e-37
KEGG Definition: hypothetical protein
Accession: ani:AN2763.2 Score: 389 E_value: 9e-37
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB37YG18FM1
TTGGCAGATACCAAAGCCGAGCCCGTTCGAAGTGTTCGGGTGACCCTGCG
AGGGCCTTTCGAAAAGATTGGTGGATTCCCATCTCGGTTGCGATCCGAAC
AGCATGACCCGACAGCTTCCACGAAAGCTCCGTAAGCCAGAAGGCTCCGA
TGCAGAGTGCGCGGATGTCATCCATCTGATGATAACGGTCGAACATGGAT
GAAGAAACAAGGCGGAGGAATTCCCGACAGAGTTTTGGAAAGAGATGGTG
GTGTTGGGGAAGATGCAGTGACGATACGGTAAATATCGCAGCGGTTAACA
AGCATGAAGAAGCCCGAGCAGCCTCCAAAGTGTTATGCGTCAGAGCGATA
TCAAAGAGATAGTGGTTGAGAGAATCCCTAAATCTGCAATGGAATTAGCT
TTGATGAGAAAACCCTGGCGTTAAATATTCTCTAG

Sequences in the Contig:

SY0AAB37YG18FM1