Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB37YF21FM1
Length(NT) : 512
Best Gene Model Blast : Link to GSTUMT00008626001 E-value : 1e-117
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_11575
Accession: ref|XP_001587582.1| Score: 105 E_value: 8e-06
KEGG Definition: hypothetical protein
Accession: ncr:NCU08174.1 Score: 94 E_value: 7e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB37YF21FM1
TTGGAGAATCCGTTTCCATGCATCGAGAAAATGTCTATGCAGCAACAATA
CGCTTACTCGGACAATGGAGGAAAGTCGAAGAAGCCGAGGGTCTACACGC
GAGCTGAGTGGGGCGCCCAAAAGGATAAGATAAAGTTACATTACTTTGAC
GAGGATAAGAATCTGTCGGATGTGAAGGGAATTATGAGTTCTCGATACGA
CTTTCATGCAACGTCCATCTCACCCACCCTTCGCCAGGTGAATTTTACTA
ACGGGTTCAAAGAGAGAAGCAGTACAAAACGAGGATTAAAGCCTGGGGCT
TGGAGAAGAAGGTGAAGACAGAGGAGATGAAAGCCATCATCAGAATCCGA
GCAAAGCGAAAGCGAGAAGGAAAGGACTCGATCTTCACTGTTCGCAAACG
AATCGTGCTGGAGCAGAAGATTGAGAGATTCCAAAAGTCCCACAAAGAGC
CAATCTTCCCCGAGTCCCCACCGCGTATGGTCTTCTCTGTTGCTTTCTAC
CTAAAACTGGGC

Sequences in the Contig:

SY0AAB37YF21FM1