Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB37YC14FM1
Length(NT) : 641
Best Gene Model Blast : Link to GSTUMT00010022001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001543916.1| Score: 136 E_value: 9e-07
KEGG Definition: No Hit Found
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2888 Score: 118 E_value: 3e-07
PFAM Definition: No Hit Found

Sequence:
>SY0AAB37YC14FM1
TTGGCGACTCGCCGGCAATCTCTGTTCGAAACTCGTCATCTCTCTCGCCC
CTCACTTGCTGATGACATTATACTTGGTCCGCCCAAGATGATGTTCGCAT
CCTCGTCCACTCGAATACCTTCCGGAAAGTTTGACCACGATTCCCACACT
ACTTCTTTAGCCTCGCCAGTTATTGATGAAGATCGTGAAAGCTCCCGTTT
CGAACGGTTTAGAATGGGTGGGGGTATTAGGCTTGGCAAAGAGATGGACA
AAGATCGTCCTGAACGCAGTAGCTTGCGCGGGGACCATACTAAACGAGGC
TTCGGTAGAGACGATGCTGAAGGTTGGACTAGTGTGTCCCGCCAACCTCG
CAAGAGCTTTGGGGCGGAGGACGGTGATCGTTTCCGTGGTGCTGGTGATA
GGGGAAAGAGGGAAAATCCATGGGATAAGGACCGTCCGCCCAAATACGAC
AATTTCGGTAGAGAACGTGAACATCGTCCAAGGGGGAGGAGGGATGAGGC
AAGCTGGTTGCTCGAAGATCGTGGTACCGACAGGGGAGGAGACCGCGACC
ATTACCGTGACCGCGACCACCACCGTTATAACAGCAGTAGCAACAGAAAC
GAGAAGGACCCCGAATGGATGGATTCAGGTCCAGGCAATGA

Sequences in the Contig:

SY0AAB37YC14FM1