Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB37YB16FM1
Length(NT) : 639
Best Gene Model Blast : Link to GSTUMT00004244001 E-value : 1e-16
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001266512.1| Score: 159 E_value: 2e-11
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_5G00570 Score: 150 E_value: 2e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB37YB16FM1
TTGGATCACTTAAACGAAGATATTGTTTTTGAGATCTTGCCTTTTAGCCA
TGCCTTCCTCAGTCGACCCAAATGATGAACGCCAACAACAACTCATACAG
GAAATGCCCGGGATTACAATGGAGATCATCCAGAGCGGCTTGATGAGGTC
CAATTGGGCAGATCTCCTAAGCGCAGCCCCCCTCTCGGTTTCTATATTGG
GACAGTGCTTTATTGCCGCTTCGGCGCCGGTAGCATTGACGATGACTTTG
GAGAAAGGTGGTGAGGAGGGTTCGCTCATACCTCACCGTTCCTTACGGGC
CAACTTGTTCCACTGTGGAAATATCGGGCAGCGGGCATTCATGGACGCTC
AATCGAGGATGCAAACTTTGACCACGCTATCCAACCATATTTGCAGGAAT
AATGGGGTTGTAAGGATAAAGCCTATTCCTTCTTCCTCTTGTTCTCCCCA
AATGGGGCCTGCTCACAGATTTCTTTGGATAGATCAATCAAATACTCGCA
GTGTTGGATGACCCGAAAACCGCGAAAAAAACACTTCGTCGGTTGATGAG
TAGACTTGAAACATCATCTCGTCGATGTAAGGAGGAAGCGGAAGCAATGG
AGAAACAATTTGATTCCTGGAAGGAGTTTGTCTCAAATC

Sequences in the Contig:

SY0AAB37YB16FM1