Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB37YB12FM1
Length(NT) : 555
Best Gene Model Blast : Link to GSTUMT00010981001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001537336.1| Score: 632 E_value: 2e-64
KEGG Definition: hypothetical protein
Accession: fgr:FG05069.1 Score: 622 E_value: 1e-63
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG4372 Score: 366 E_value: 5e-36
PFAM Definition: DUF676, Putative serine esterase (DUF676). This family of proteins are probably serine esterase type enzymes with an alpha/beta hydrolase fold...
Pfam Number: pfam05057 Score: 283 E_value: 2e-26
Swissprot: P53118|ROG1_YEAST
Gene Ontology:
GO:0016298 = Molecular function: lipase activity
GO:0005515 = Molecular function: protein binding
GO:0006629 = Biological process: lipid metabolic process

Sequence:
>SY0AAB37YB12FM1
TTGGCTAAATGGAAGTCGAATAAACCGCATCTAGCTGCTCCATCTTTTCC
GGCTTTAGAAGACATTCCACCATACGAAATCACCAGCATCTCTTTTATTG
GGCATTCGCTTGGGGGCCTTGTTCAGACATATGCAATAGCATACATACAT
GCTCATGCGCCCGACTTCTTCACCTTGCATAAACCTATCAATTTTGTCGC
ACTCGCAACCCCGTTCCTGGGTCTTTCCAATGAGAACCCAATATATGTCA
AGTTCGCCCTGGATTTTGGTCTAGTGGGACGCACAGGACAGGATTTGGGG
CTTACATGGCGTGCACCTTTTCCGCTGCCCACATTTTCCAAACCGTCCAA
CCCTAATGAAGCAGATACCAGCAAGCCGTTACTGCGTATACTTCCAACAG
GACCAGCCCATGATGTTTTGAGGATGTTCAGGAATCGAACAGTTTATGCA
AATGTGGTTAATGATGGGATCGTACCACTAAGAACTAGCTGTCTGTTATT
CCTAGATTGGAAGGGTCTTGGCAAAGTTGAAAAGGCCCGGAGAGAGAACG
GAGCA

Sequences in the Contig:

SY0AAB37YB12FM1