Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB37YA03FM1
Length(NT) : 589
Best Gene Model Blast : Link to GSTUMT00011590001 E-value : 1e-166
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_07170
Accession: ref|XP_001243274.1| Score: 240 E_value: 6e-19
KEGG Definition: hypothetical protein
Accession: mgr:MGG_00432 Score: 215 E_value: 3e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB37YA03FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGAAAAATTCACTTCCACCA
TCAAACACCATCATCAAACGCAGTGAGATTAGTCTCCATCAAACAAACAC
TCAACAATAATGGCCGCTACCAAATCCAAGTCCGATGTCCCTCCTGAAAA
CCAAGCTCCATCTAGCTCTAAGGCCGCCGCAAAGGGAAGTCACCGTAGGG
GGAGTTCTTCCGTCACCGACGTTTACAAACCAGCTGAACTCAGTATGTCT
TGCTGGTTTATCGGCTTACTGACAAGGATGCTAATCAATTCACAGAGGAC
ATCATCGGAGAGGAGGGAACTTTAATGGTTGCCAAAGAGATCTCTAGATT
GAACTGGAAATTGAATACCCATCCCTCGCATCTCGATGACTGGAAATCTC
TCAAGGAAATCCCAATAACCACCCCCAAAGTCAAGCTGTTAGACGTTTAC
TTTCCTCTCGGATTGCATGTCACCGCCCGTGCGGGCTCATCCTCCACTGT
TGGTGTTAGTGTCTATGACGTGCTGGTCGCGATTCACAAGCAGTTCAAGA
AGAAAGCGGATGACGAACTTGAGATGCCCGTTCTCGGAA

Sequences in the Contig:

SY0AAB37YA03FM1