Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB36YO22FM1
Length(NT) : 623
Best Gene Model Blast : Link to GSTUMT00010243001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_02982
Accession: ref|XP_001229498.1| Score: 682 E_value: 4e-70
KEGG Definition: hypothetical protein
Accession: fgr:FG05509.1 Score: 674 E_value: 2e-69
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1614 Score: 693 E_value: 6e-74
PFAM Definition: RNase_PH, 3' exoribonuclease family, domain 1. This family includes 3'-5' exoribonucleases. Ribonuclease PH contains a single copy of this domain, and removes nucleotide residues following the -CCA terminus of tRNA. Polyribonucleotide nucleotidyltransferase (PNPase) contains two tandem copies of the domain. PNPase is involved in mRNA degradation in a 3'-5' direction. The exosome is a 3'-5' exoribonuclease complex that is required for 3' processing of the 5.8S rRNA. Three of its five protein components contain a copy of this domain. A hypothetical protein from S. pombe appears to belong to an uncharacterised subfamily. This subfamily is found in both eukaryotes and archaebacteria..
Pfam Number: pfam01138 Score: 235 E_value: 9e-21
Swissprot: O74918|RRP45_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAB36YO22FM1
TTGGAGTAAACATATCCCCCAACAATTAATCCCACCACCTCTGCTGCTCA
AAGTACGACGAAATGCCGAGGGAGATAGATCCGACAATTAACGAAAAGAG
CTTCATTCTCGACGCGCTAAACCAAAAGCTCCGAATTGACGGCCGGGACT
TGGACTCCTTTAGAGAGTTGGAGCTTAACTTCGGAGATGATTATGGACTC
GCAGATGTGCAATTGGGAAAGACCCGTGTCCTCGCCCGTGTATCCGCGGA
AGTAGTAAAGCCCTTCACCGACCGTCCGTTCGATGGAATCTTCACAATAA
CGACAGAGCTAGGTCCTATGGCCTCCCCAGCTTTCGAGCCCGGCCGTCAA
ACCGAACAAGAAGTCCTCCTTTCCCGTCTCATCGAAAAGGCCATCCGTCG
CTCAAACGCACTAGACACCGAATCCCTCTGCATCGTCGCCGGACAGAAGT
GCTGGCAAATCCGCGCAGATGTGCACTTCCTCTCCCACGACGGTGCCCTC
GTCGACGCCTCGTGCATAGCCGTGGTGGCCGCGCTCCAGCACTTCCGCCG
CCCGGACGTCTCGGTTGAGGGTGAGAAGGTCACCATCCACACAATGACCG
AGCGGATCCCCGTGCCCCTGTCT

Sequences in the Contig:

SY0AAB36YO22FM1