Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB36YN18FM1
Length(NT) : 541
Best Gene Model Blast : Link to GSTUMT00011264001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_12833
Accession: ref|XP_001586255.1| Score: 462 E_value: 9e-45
KEGG Definition: ATP-depentend DNA helicase, putative [EC:3.6.1.-]; K03657 DNA helicase II / ATP-dependent DNA helicase PcrA
Accession: afm:AFUA_2G03910 Score: 445 E_value: 4e-43
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG2108 Score: 211 E_value: 3e-18
PFAM Definition: UvrD-helicase, UvrD/REP helicase. The Rep family helicases are composed of four structural domains. The Rep family function as dimers. REP helicases catalyse ATP dependent unwinding of double stranded DNA to single stranded DNA. Some members have large insertions near to the carboxy-terminus relative to others in the family..
Pfam Number: pfam00580 Score: 326 E_value: 2e-31
Swissprot: Q10213|SRS2_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0005819 = Cellular component: spindle
GO:0006301 = Biological process: postreplication repair
GO:0000725 = Biological process: recombinational repair
GO:0031297 = Biological process: replication fork processing
GO:0009411 = Biological process: response to UV

Sequence:
>SY0AAB36YN18FM1
TTGGCTTTGGATTTATCTATTCGGACAGCTTGATGCCATGTCTTTTAGGG
CATCACAGTTAGATCTTGAGCCGATACTTGCCGGACTGAACAATGCCCAA
CGACTAGCTGTGACGAACCCGTCGTCTGTGGTACAGATACTTGCCCCACC
TGGTTCCGGTAAAACTAGAACACTAACCTCTCGCGCCGCATGGCTACTAT
GTCCTCCGCAGTCGCTGGACCCCCGAAATGTCATTGTGGCTACTTTCACC
GTTAAAGCTGCCCGGGAGATGAAGGAGCGGATATCGAAGCTCGTTGGGAA
CGGAGTGGAAGGTCGGCTGGTGCTGGGCACTTTCCATTGTATAGCTAGGA
AGTACTTGGTAAAGTATAGGCATCTGGTAGACATCAAGCCGGGGTGGGGA
ATTGCGGATTCCAGTGATAGTTTGGGAATTGTCAAGAGGATAATCAAACG
GAGGAAATCGCCATTGGATCCAAGCCAGGTTAGATCTCGGATATCCTATT
TCAAAGCCCGAAATAGCTCTCCGGTGGCAGATGCCCTACCA

Sequences in the Contig:

SY0AAB36YN18FM1