Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB36YN08FM1
Length(NT) : 399
Best Gene Model Blast : Link to GSTUMT00008553001 E-value : 2e-39
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: TT_ORF1, TT viral orf 1. TT virus (TTV), isolated initially from a Japanese patient with hepatitis of unknown aetiology, has since been found to infect both healthy and diseased individuals and numerous prevalence studies have raised questions about its role in unexplained hepatitis. ORF1 is a large 750 residue protein..
Pfam Number: pfam02956 Score: 118 E_value: 1e-07

Sequence:
>SY0AAB36YN08FM1
TTGGGGATCTGGAACTCGCGGGGGATTACCTTGAGCATAGCTTGAAAACT
TTACAATGGTTGACTTCCAAGGGGTGTCGGTAGATGACGATTTTTCTTCT
TCTTTTTTATTCGTTAGGGACATGGGTTTTTCTTCTTCTTCGCCTCCTCC
TCCGCCTCCTTCTTCACCTCCTCCTCCTCCTCCTCCTCCTTTCTCCTATT
CTTTTCTTTTTACATTCGTTATTCGGTGTTATTGTCTTTTTTTTCGTCTC
TTTTTTTCTCTTATTTCCAGGGGCGTCAAGGGTTCGACGATCAAGGGCTA
TCGTTATGCAAATTTTTTTTATGGGAAAATGCACGAAAGCGAGAGGGGGA
TCAAAGTCGATGCGCATCCTTTCCGTGGTTAATGTGCATTACACAGATT

Sequences in the Contig:

SY0AAB36YN08FM1