Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB36YN06FM1
Length(NT) : 638
Best Gene Model Blast : Link to GSTUMT00005226001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: NADH-ubiquinone oxidoreductase subunit B17.2
Accession: ref|XP_753979.1| Score: 482 E_value: 7e-47
KEGG Definition: NADH-ubiquinone oxidoreductase subunit B17.2, putative [EC:1.6.5.3 1.6.99.3]; K00329 NADH dehydrogenase; K00356 NADH dehydrogenase
Accession: afm:AFUA_5G06540 Score: 482 E_value: 3e-47
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG3382 Score: 259 E_value: 2e-23
PFAM Definition: NDUFA12, NADH ubiquinone oxidoreductase subunit NDUFA12. This family contains the 17.2 kD subunit of complex I (NDUFA12) and its homologues. The family also contains a second related eukaryotic protein of unknown function..
Pfam Number: pfam05071 Score: 217 E_value: 1e-18
Swissprot: Q9N2W7|NDUAC_CAEEL

Sequence:
>SY0AAB36YN06FM1
TTGGGCCTACCCGCAAGGATGTCGACACTTACAAGGACCCTGAAGTATCT
CTTACGAATCGGACCCCGCCAATATGTGTACCAGATGAACCGCATTGGTG
ATACCAAGGCCGGAACTCTCGTTGGCACAGATCGTTCCGGAAACAAATTC
TATGAGAATAACGAAGAAGAGTTGCCGTTGAGGACAAAATGGGTTGATTA
CAAGGAGTGGAAGGAATACGATGCTTCGCACGTTGAACCTGGATGGCATG
CTTGGCTCGCTTATATGGTCGACAAACCGCCTGGGGCCGAACCTGTTCTG
AAGCACGAAGTTAGATCTTGGGAGAAATCAGAGCACCTCGGCAATCTAAC
TTTCAGTCGGGGTGCATATAAGCCTTACTCCACGACAAAGCCGAAACTTG
GTTCTTGGGAACCTGTAGCTAGACCTAGAACATAATTTATGAGGGATTTC
TGCGTTCTGGTGATAGTTCCTTGCGTTAACAGACTTTTTTCTTTTTCTCT
CCTGTCTGAATAGAGTTCCGTTTTGAGATATCAAACTCTTACATACGAAG
TTGCGAGGAGGGCCTTATTTAGTTTGGCATACCGTATTTTTGCTCAGGGT
TTCAATAAGAATGACTGGGATATCAGAGTGATATGTCA

Sequences in the Contig:

SY0AAB36YN06FM1