Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB36YM22FM1
Length(NT) : 651
Best Gene Model Blast : Link to GSTUMT00007796001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_09224
Accession: ref|XP_001799523.1| Score: 401 E_value: 2e-37
KEGG Definition: hypothetical protein
Accession: spo:SPAC2F3.12c Score: 354 E_value: 2e-32
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones, Energy production and conversion].
Kog Number: KOG1672 Score: 449 E_value: 1e-45
PFAM Definition: No Hit Found
Swissprot: O14095|YERC_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAB36YM22FM1
TTGGTACTCGAGTACAACTGCCGCCACATCATAACCAATTTGATAATCCT
TCCCAAAAGGTAGAATAAGAACATGACCAACATCGACCCCACGGTCGCCA
AAGTCCTGGACAAAGACCGTTCAAAAGATGAAGACGAAGATGAAGACACT
CTCCTAGAAGAACTCGAATCCGACACCGCAGCTCTGGGCGCCTTCCGCGA
GAAGCGTATGCAGCAGCTACACGACGAATTTCACCGCGCTCGCGTAATGA
AATCCCTCTCTCACGGCGCCTACACCCCGTCCACGAACGAGCGTGAGGTG
TTAACGCACACTACCACATCTAAATTCAGCATAGTGCACTTCTTCCACAA
GGACTTCAACCGTTGCAAGATCATGGACTCTCACCTGGAGGTTCTAGCGC
GGAAGCACTTTGACACCAAATTCACCAGCATCGACGTCGAGAAGGCGCCC
TTCCTCGTGGAGCGGTTGAAGGTTCGGGTACTGCCGTGCGTGATCGCTTT
CGTGGATGGGAAGAGCGTGGATCGGATTGAGGGCTTTGCAGAGCTAGGGA
ATACGGATGGGTTCAGTACGAAGATGCTCGAGTTGAGGCTGCTGGCTTGT
GGGGTTTTAGTGAGGGAGAAGGTTGATGAAGATGCTGAAGGGGTTGGGGG
G

Sequences in the Contig:

SY0AAB36YM22FM1