Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB36YH16FM1
Length(NT) : 637
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001543333.1| Score: 523 E_value: 1e-51
KEGG Definition: hypothetical protein
Accession: ani:AN3547.2 Score: 466 E_value: 2e-45
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1840 Score: 284 E_value: 2e-26
PFAM Definition: No Hit Found
Swissprot: P46825|KLC_LOLPE

Sequence:
>SY0AAB36YH16FM1
TTGGCATGGATCGGCGTGCGTTGGCGGGTCGAGAGAAAACGCTCGGGCTA
GACCATCGAGATACCCTACTGAGTGCCAACAATCTTAGTGTGACTCTGCA
TAGTCAAGGAAAGTACGACGAAGTTGAGATCTTGGATCGACGTGCATTGG
CGGGCAGAGAGAAAACGCTCGGGCTGGATCATCGAGACACCTTGCTGAGT
GTCAGCAATCTCGGCACAACTTTGCGTTGTCAAGGAAAGTACGACGAAGC
TAAGGTCATGTATCAACGTGCATTGGCAGGCAGGGAGAAAACACTCGGGC
AATACAATCGAGATACCTTACAGAGCGTTCGTGATCTGGGTATGGCGCTA
CATTCTCTGGAAAAGTACGGCGATGCCGAGGATATGCATCGACGTGCATT
AGCAGGTAGAGAGAAAACGCTCGGGCTGAACCATCGAGGTACCTTACAAA
GCGTCCGTGATCTGGGTGTGGCGCTACATTGTCTGAAAAGGTACAGCGAG
GCCGAGGATATGTATCGATGTGCGTTAGCGGGTAGAGAGAAAACTCTCGG
ACTAGATCATCGAGATACATTACAGAGTGTTCAAGATCTAGGTGTGGTGC
TGTATCGCCAGGAAAAGTACGACGAAGCGGAGATTAT

Sequences in the Contig:

SY0AAB36YH16FM1