Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB36YH14FM1
Length(NT) : 601
Best Gene Model Blast : Link to GSTUMT00010106001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: decapping enzyme Dcp2, putative
Accession: gb|EDP51979.1| Score: 262 E_value: 2e-21
KEGG Definition: decapping enzyme Dcp2, putative
Accession: afm:AFUA_5G12420 Score: 262 E_value: 1e-21
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG2937 Score: 191 E_value: 1e-15
PFAM Definition: No Hit Found
Swissprot: Q9CYC6|DCP2_MOUSE

Sequence:
>SY0AAB36YH14FM1
TTGGATTGAGGGAAGGGTCCATAGTGATCATTTTGTTGAAGTCACAATGA
GGGAGCAGAATATGAGGTTATATATCATTCCCGGAGTACCTGAGGAAACG
AAGTTTGAGCCAAGGACAAGGAAAGAGATCAGTAAAATCGCATGGCATCA
TTTGTCTGACCTACCAACCTTTTCAAAAAAGAAGAACCAACAAAACATCC
AACAATCTGACGTTCGAACAGGAAAGTACTATATGGTTGCCCCATTCCTC
AAAGAACTCCGTAAGTGGATTTCAACATCTGGAAAGAAATGGCTTGAGGA
GCAGAAACAGATGCCATCTTCGGCGACTCTCATCGGCGATGAGACAGAGA
TAGAAGATATTATTCCACCGCAAGCCGTTGATTCTTCGGCAGAATTAAGA
AATCTCTTAGGTATCCCGCACAACGGGGCCGCCAAACCCAACGGAAATTA
TAATACCACTGGAACCGACGAGGCTACTGCGAGGCTTAAGAATTTTCTCA
ATCTTTCTGGGCCTGTCACAGAACCTGTGGATGCTTCCAGCAAACTCAAG
TCTTTACTCAATGTGGGTGGGGGAAGTAACACCCAGATAACGGAGCAATC
G

Sequences in the Contig:

SY0AAB36YH14FM1