Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB36YF10FM1
Length(NT) : 523
Best Gene Model Blast : Link to GSTUMT00003002001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_06971
Accession: ref|XP_001591525.1| Score: 133 E_value: 1e-06
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB36YF10FM1
CCATACTCTACTTGCCTCAACAAGACGAACACTATGCCACTTCCAGCTTA
CGCGTCAAGCTATCAAATCCACTGCAGCACCTGCACCTATTCTGTTGATC
GCCAAAAATCAGACTCTCGCCACTTGAGTTGCTGCGGAAGAATAGTCTGT
GGCGACTGCATAGCTAAAAACCCTCGATTTGGAATCTACTGCCCGTTCTG
CCAATCACCTTTCCCCAAACGAAGTGGGGATGGGGGAGGTGAAGCAGAGA
GGGAAACTCCATTCCGACCGCTGCCTCCTCCATACGCTCCCTCAGCCCCA
AGCCCCCCTCCACCATCATACTCCACAAACGGTGGGGTAATCCACTACGT
CCGCGCGGCGGATACACTCCCGACCATAGCTCTCCAGTATAACCTCCCCC
TTCCACTATTACGCTCACATAACCGCATATTCTCCGACCACCTCCTACAG
GGCCGACGGAGCGTGGATATTCCATCGCCGCCGTACGTTGGACCCTCACT
GTCTCCAGCGCCGGAAGACGTAG

Sequences in the Contig:

SY0AAB36YF10FM1