Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB36YF02FM1
Length(NT) : 580
Best Gene Model Blast : Link to GSTUMT00007805001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: 30S ribosomal protein S10, mitochondrial precursor
Accession: ref|XP_001214807.1| Score: 379 E_value: 5e-35
KEGG Definition: mitochondrial tryptophanyl-tRNA synthetase [EC:6.1.1.2]; K01867 tryptophanyl-tRNA synthetase
Accession: aor:AO090701000003 Score: 352 E_value: 3e-32
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG2713 Score: 387 E_value: 2e-38
PFAM Definition: tRNA-synt_1b, tRNA synthetases class I (W and Y)..
Pfam Number: pfam00579 Score: 139 E_value: 9e-10
Swissprot: P04803|SYWM_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0042802 = Molecular function: identical protein binding
GO:0004830 = Molecular function: tryptophan-tRNA ligase activity
GO:0006436 = Biological process: tryptophanyl-tRNA aminoacylation

Sequence:
>SY0AAB36YF02FM1
TTGGAGAAGGACGTCTTAAAATTACCCATCACCCTCCTCTCACCGGCAAA
GCGCGTCATGTCGCTCAAAGACCCCACGCAAAAAATGACCAAATCAGCCG
CTGATCCTGCTTCCCGCATTCTCCTGACAGATTCGCCAAAAGAAGTTCAC
GGCAAGCTCAGAAAGGCTATAACGGATAGTGTTCCAGGCCCCCCGACCTA
CGACGTGCAGAACAGACCGGGTCTTTCAAACCTCATTGAGATACTCGCTC
ACGTCCAACGTCGACAGGACTTTGACGAGGTTGCGAAGGAAGTCTCAGAT
TTGAGTCTTAAGGCGTTCAAAGAGCTTGTGGCAGACGCCATCAGCGAGCA
CTTGGAACCCATCCGGGATGAGTACGAGAAGATCATGGCGGAGAGTAATA
GAGAAGTGCTGCACTTTGTAGCGAGTGAGGGGGAGCGGAAGGCTCGGGAG
AGTGCAGAGGAGACGTTGGCGGAGGTTAAGGAGGCGGTTGGATTATAAAA
AGCGTTAGAAAAAGAAAAAAGGTTACCACGCCCCTCTGTATACGGTATCG
TACCATATTTACTTTTAGTTTTTCCTGGGT

Sequences in the Contig:

SY0AAB36YF02FM1