Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB36YD24FM1
Length(NT) : 587
Best Gene Model Blast : Link to GSTUMT00004017001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_10628
Accession: ref|XP_001550904.1| Score: 345 E_value: 4e-31
KEGG Definition: predicted protein
Accession: aor:AO090023000898 Score: 331 E_value: 9e-30
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG1996 Score: 243 E_value: 8e-22
PFAM Definition: G-patch, G-patch domain. This domain is found in a number of RNA binding proteins, and is also found in proteins that contain RNA binding domains. This suggests that this domain may have an RNA binding function. This domain has seven highly conserved glycines..
Pfam Number: pfam01585 Score: 105 E_value: 8e-06
Swissprot: P42698|DR111_ARATH

Sequence:
>SY0AAB36YD24FM1
TTGGCCCGACCGACGAACCCACGGACCAATCTCCCCCATCCCCGCCATCG
AACCCCCTCCTCCCTGGCCAGAAGGACTTCGCCGCACGTCTGATGTCAAA
ATTAGGCTGGCGCGCTGGCACAGGCCTCGGCGCCTCGAGCACAGGCATAA
CCCAACCCCTCCGTGCTGTGCACACAAAGTCCAAAGACCACCCCACCCGC
GGCAAAATCATAGACAAGAATAAACCCAATCCCGCTGCCACCGCCGGCAA
ATTCGGCCCTGCGAGCGTCGTAGTGGTACTGAGGCACATGGTCGACGGCC
TAGAGGGCGAGGATGAAGCCGTGCTCATGCAGGAGATTGGCGATGAGTGC
GAGAACTCGTATGGCGGCGTCGAGCGCGTTCTTGTCGTTTGGGGGAAGGA
TGATGGGGAAGGAGATAACGCGGGTGAGAAGGCGGCGAGCAGAGTATTCG
TGAAGTTTTCGGGGGAGTTGGCGGCTCTTAGAGCAGTCAACGCCCTTGAA
GGAAGATTATTCAATGGGAATACCATCGAAGCCAGATTCTTTGATAAGGA
TAAGTTTGAGGATCGCGAATTTGATTGATCTACGTAC

Sequences in the Contig:

SY0AAB36YD24FM1