Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB36YD18FM1
Length(NT) : 518
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: emb|CAO69574.1| Score: 133 E_value: 1e-06
KEGG Definition: predicted protein [EC:3.2.1.113]; K01230 mannosyl-oligosaccharide alpha-1,2-mannosidase
Accession: olu:OSTLU_1811 Score: 133 E_value: 6e-07
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2204 Score: 150 E_value: 5e-11
PFAM Definition: Glyco_hydro_47, Glycosyl hydrolase family 47. Members of this family are alpha-mannosidases that catalyse the hydrolysis of the terminal 1,2-linked alpha-D-mannose residues in the oligo-mannose oligosaccharide Man(9)(GlcNAc)(2)..
Pfam Number: pfam01532 Score: 136 E_value: 2e-09
Swissprot: P45700|MA1A1_MOUSE
Gene Ontology:
GO:0000139 = Cellular component: Golgi membrane

Sequence:
>SY0AAB36YD18FM1
TTGGCGGGGCTCTGGGATTGGATGTTCGGTGCTTCCAGCCGAGACATTGA
AATATCTCTATTTGACGTTCACTAGTGAAGACGTTGGGAGCCTGGACGAA
TGGGTTTTCAGCACCGAAGCACATCCGTTCCGAATAATGCGGTGATTGAT
GGAGAAGGGGGGAGGGTTGGTTGGTCGCTGGTTGCCGTATGATACCACAC
AAGATGGTACAAGAACCGACTATGACCAACTAACCCCACTATGACGAGGG
GAGGGGTACCGTAGCTCAGGTAAGTAATTAAGGAACCAATATCAGAGCTT
TATGCTACGGTGCTGCAGGGTGCGGTATCGACAGATGGTGGTACGGGGAG
GGGGTATCCTTTTGTTTCTTGTTTTATCGTTTTTCCTTTTTACTTTTCTG
TTCTCCCGGTTTTAAGAATGAAAAGTTTGGTACGAAGCGAAAGAAAGAAT
GGGGGAATGAGTGAGCGGGTGAATGATATGTGGGGACAGCATCATGTCAT
CTCATAATTATCACGTCG

Sequences in the Contig:

SY0AAB36YD18FM1