Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB36YD12FM1
Length(NT) : 572
Best Gene Model Blast : Link to GSTUMT00008395001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_05309
Accession: ref|XP_359468.1| Score: 208 E_value: 3e-15
KEGG Definition: hypothetical protein
Accession: mgr:MGG_05309 Score: 208 E_value: 2e-15
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB36YD12FM1
TTGGGTGCCTTTTCGGCTTGCCAGGACGCGGAAAGGGAGCTGGTCATATG
AGCTTTAGGAGGTATATATACAGCGCGAGAGTGTGGATTTGGATTAAAAT
CTGGGGCGGATCTCCAGAAGCGTTGCCTTCGTTGCTATCCCCACCACCCT
CTTCCCCGTCTGCACCTCCAACACCTGATTCCGCTCGATCTCCTCGTTCC
GCCCTCCACAGCGGCGGCGGCTTGAGGTCACTGAAAACTGCATTCAAAGC
CGGTCTTACAGACACCCGTCTCTCGCTTTCTTACCTAGCCGGATTCGTCG
CCCGTGCAACATCAGTCGGAATATCACTCTTCATCCCCCTCTTCGTAAAC
GCATACTTTATCCATCAAGGCCTCTGCCCCCCTTCAACGCCCCCCTCGCC
AGCCCCGCAAACCTGCAGGCAAGCTTACATACTCGCCGCAAAGCTCACGG
GCACAACACAGCTAACCGCACTCTTGCTCGCTCCCGCGTTCGGTTTTTGG
GCCGATCATGCGGCGGCAAGGGGTCGGCGGAATACTCCATTGGTGGTGTC
GGCGTTCCTAGGCGTCGTCGGC

Sequences in the Contig:

SY0AAB36YD12FM1