Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB36YB23FM1
Length(NT) : 573
Best Gene Model Blast : Link to GSTUMT00006322001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: MAP kinase kinase kinase (Bck1), putative
Accession: gb|EDP52640.1| Score: 169 E_value: 1e-10
KEGG Definition: MAP kinase kinase kinase (Bck1), putative
Accession: afm:AFUA_3G11080 Score: 169 E_value: 5e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB36YB23FM1
TTGGGAGTCCGTCACATCAAGCACCGTGAACCACAGGCCAGGAGATGGGA
AGGGCAAAGAGAAGGCCCTTATTGTTCTGGGCATAACGCAGAACGAACGG
CCGATTGCTCGCCAGGATCCCGATGGGAAATCGGGTTCTGGTCTTGTAGA
TAGGTTTCGAAAGAAATTCCGGAGGGAGACTTCGGATGATGATAACGAGG
ATGGTTCTCCCACAGGGCTGGGAACCCCGAATCTACCATTCACAATTCCT
GAGAATAATGCAAGTGACTCTTCACTTGAGCAGGCCTCGGTTTCGTCTGT
GGATGCCTTGAGGGGGAGAGCAAGTAATCCGAGATCTGCTCCTGGTGGGG
GAACTCCAAAGAGCAGCAAGCCGGTATATGTGTTCGCGACAAGAGATGGA
AAAGTATGGGTATCTATAGATGTGACGAGTTTAGAAAAAGGAGGGGAGAT
CAGAAAGGAAATTTGTCGCAATCTTGGAATCAACGACTATGATGTAGCAG
CTATTCACCTGACTGAGGTTGGCCAAGAACCTAACGATGAGACTTTAACA
GACCAGATGCTCAAGCTGTCTTG

Sequences in the Contig:

SY0AAB36YB23FM1