Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB36YB01FM1
Length(NT) : 609
Best Gene Model Blast : Link to GSTUMT00002161001 E-value : 3e-79
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_501429.1| Score: 346 E_value: 4e-31
KEGG Definition: hypothetical protein
Accession: yli:YALI0C04180g Score: 346 E_value: 2e-31
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0169 Score: 290 E_value: 3e-27
PFAM Definition: PI-PLC-X, Phosphatidylinositol-specific phospholipase C, X domain. This associates with pfam00387 to form a single structural unit..
Pfam Number: pfam00388 Score: 161 E_value: 3e-12
Swissprot: O13433|PLC1_CANAL

Sequence:
>SY0AAB36YB01FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCACCTCCCCGTCATACTCTC
ATTAGAAGTCCACTGCGATTTGGAACAACAGGTTGAGATGGCGAAAATTC
TTCGTAGCGTCCTAGGTGACGCACTTGTTACAGAGCCTTTCATGACAAAC
ACGTTAATTCTACCAAGCCCAAACGTATTAAGGAATAGGATCTTGGTCAA
GGTCAAAGGCAGCTCTAGGCAAGACACCTTAATGTCAAACAACGACTTCG
GCTCAACGGAAAAACGGGCCGGGAGCACCAATAATCTCCCGAACTCTTCA
CCCCCGCTCCCTAAGAGCGGCATACCGAGCGAGACCAGCAGCTCCACAAG
TGAGTCCGAAGGCCAAGACGAGAGCAAGGTCAAGAGGAGGCAGGAATCTG
TGAAGATTGCGCACGAGTTAGGTTCTTTAGGCGTTTATACTAGAGGACAG
CGGTTTTCGAACTTTGCGCTGCCCGAAAGCAAAACCTCCAACCATGTGTT
CTCTTTTCAAGAGAAGAAATTCGAAAAATTCGCAAAGGATCCGGAAAAGA
AGGTTCAATTAGAGAAGCACAATGTTCGGTACCTCATGCGAGTTTACCCA
TCTGGATTT

Sequences in the Contig:

SY0AAB36YB01FM1