Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB35YN24FM1
Length(NT) : 636
Best Gene Model Blast : Link to GSTUMT00011588001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: putative histidine kinase HHK12p
Accession: gb|AAR29891.1| Score: 486 E_value: 2e-47
KEGG Definition: hypothetical protein
Accession: ncr:NCU00939.1 Score: 436 E_value: 7e-42
KOG Definition: No Hit Found
PFAM Definition: HATPase_c, Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase. This family represents the structurally related ATPase domains of histidine kinase, DNA gyrase B and HSP90..
Pfam Number: pfam02518 Score: 162 E_value: 3e-12
Swissprot: O82436|ETR1_CUCMR
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane

Sequence:
>SY0AAB35YN24FM1
TTGGGGAGGATAGTAATTTGGATCTGGAGGAGATGATTGATTCAGCGTCC
ACAATTTTGGTTTGCGTGCAGCATCAGATGCGGATCATAGATGACGTTCT
TACCCTTAGTAAGCTAGACTCGATGCTTCTGAGTGTCGTGCCTGTAGTTG
TACAGATTCATGCGGTTATATCCCAATTGATGAAGATCTTCCAGTCTGAA
TTGCACGTGAAGGGCATCACTTCTGAGTTTATCCTCGAGGAATCTTACAA
GGAGCTGAGTGTTGATTGGGTTAAGGCTGATCCAGCACGGTTCTCGCAGA
TTTTGATGAATCTTTTGACAAACGCTATCAAATTCACCTCCCAGCAAGCT
GGAAAACGGGAGGTTACTATCAAGCTAGGAGCGACCTTGGAGAGGCCGAC
AGCTCATGGCGAAGTCATGTACCGGGAGTCCGAGGATCGCCTTCCACAAG
ACATGGCCCAGGAATGGGGAACCGGTGACCCTATATTCATCCTGGTCACT
GTTCAGGATAGCGGTATTGGAATTAGCGCAGAGTGGCAAACGAAACTTTT
CAAGCGTTTTGAACAGGTTCCCCGTACGCACGTTACGTATGGTGGTTCGG
GCCTGGGTTTGTTCATCTGCCGTCGGCTCTGTCGTA

Sequences in the Contig:

SY0AAB35YN24FM1