Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB35YN06FM1
Length(NT) : 638
Best Gene Model Blast : Link to GSTUMT00009000001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_08024
Accession: ref|XP_001225680.1| Score: 166 E_value: 3e-10
KEGG Definition: hypothetical protein
Accession: ani:AN3320.2 Score: 141 E_value: 1e-07
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 111 E_value: 2e-06
PFAM Definition: No Hit Found

Sequence:
>SY0AAB35YN06FM1
TTGGAGAAATACGGCCTTATCGATTACGCCGCCGGTCATTGGGCAGTCCA
CCTTAGAGATTCGAAGGACCGCCAGATGGAGCTATTGGACCTTTCTACGG
CGATTTGCGACCCAAGTTCCAAGAAGTTTCAAACCTGGTTCAGAGTGTAT
TGGGAAACTTCTGGCCAGCCTGTGCATCACCCGTTCCCGTCTGACTTTAC
ACATTTGATGGTAGCATCGTGGTTTGGGCAGGAGTCACTAGTTCAGCGAC
TATTGGAGCACAGGGAATCCATCAACACTCGATCCGAGATATATGGCACG
GCATTGAACATAGCGGCTCTTCGGGGAGATAAGGAAATAACCCTGAGGCT
TGTGGCGGGAAGAGTCATTGTTCATATAAATCGGAAGCAGTTTAAAATCT
TACAGACAGTACGTGAATTGATGTCATCGATGGAAGCTAATACTAATAGA
GGACATGTGTTGCGTAATAGAGGAAGAGTGAGGTAGGGACCGGGAAAATA
TCTGGGGCAACGGTGGTAGCTAATTACAGAGTTACCGTGTTCTATAGCTA
GCTAAAGAAAATGATTGGCGACGTTATGTGCGTGAACAGGATCTAATATA
GTTCTAGAACGAGGCAACTGCTGACCTCTTGAAAAAAA

Sequences in the Contig:

SY0AAB35YN06FM1