Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB35YK09FM1
Length(NT) : 636
Best Gene Model Blast : Link to GSTUMT00003909001 E-value : 1e-113
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_04126
Accession: ref|XP_001244685.1| Score: 475 E_value: 3e-72
KEGG Definition: hypothetical protein [EC:3.4.11.18]; K01265 methionyl aminopeptidase
Accession: mgr:MGG_00966 Score: 446 E_value: 4e-71
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2775 Score: 494 E_value: 7e-51
PFAM Definition: Peptidase_M24, metallopeptidase family M24..
Pfam Number: pfam00557 Score: 220 E_value: 5e-19
Swissprot: P38174|AMPM2_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0004239 = Molecular function: methionyl aminopeptidase activity
GO:0006508 = Biological process: proteolysis

Sequence:
>SY0AAB35YK09FM1
TTGGCCTGTTTATGATAATCTCCTTGCTGCTGTGAAAGATGCTACTAACA
CTGGTATTCGTGAAGCGGGTATTGACGTCCGGATGTCCGACATCGGGGCT
GCTATCCAAGAGACTATGGAGAGTTACGAGGTCGAAATTGGCGGAACAAC
TTACCAAGTGAAGCCAATTCGCAACCTGAACGGCCACAATATCAATCAAT
TCCAGATCCATGGCGGCAAGAGCGTTCCGATTGTTAAGGGTGGAGACCAC
ACCAAGATGGAGGAAGGAGAAACCTTTGCTATTGAAACATTCGGCAGCAC
CGGGAAAGGTTATGTCCGCGATGATGTATATTTTTTCGGGTTTACTCTCT
TGAAGATGGTTTACTGATGAGGACTAGTTGGAGGTTTCGCATTACGCTAG
ACGGATAGATGCACCTAATATCTCCCTACGCCTTACTTCTGCCAAGAATA
TCCTCAATGTCATCAACAAGAACTTTGGGACATTACCTTTCTGCAGGAGG
TATCTCGATCGTCTTGGGCAGGATAAGTATCTTCTCGGGGTTTGTGCCAC
TTTGCTGTAGCATGGATGGACTGAGTTGACAAATGCAGTTGAACAATCTC
GTTGCTAGTGGTATCGTGGAAGCATATCCGCCTTTG

Sequences in the Contig:

SY0AAB35YK09FM1