Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB35YG02FM1
Length(NT) : 579
Best Gene Model Blast : Link to GSTUMT00006799001 E-value : 1e-167
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_09644
Accession: ref|XP_001799933.1| Score: 483 E_value: 4e-47
KEGG Definition: prohibitin, putative
Accession: afm:AFUA_2G09090 Score: 471 E_value: 5e-46
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG3090 Score: 496 E_value: 4e-51
PFAM Definition: Band_7, SPFH domain / Band 7 family. This family has been called SPFH, Band 7 or PHB domain..
Pfam Number: pfam01145 Score: 145 E_value: 2e-10
Swissprot: P50085|PHB2_YEAST
Gene Ontology:
GO:0005743 = Cellular component: mitochondrial inner membrane
GO:0005515 = Molecular function: protein binding
GO:0000001 = Biological process: mitochondrion inheritance
GO:0045861 = Biological process: negative regulation of proteolysis
GO:0006457 = Biological process: protein folding
GO:0001302 = Biological process: replicative cell aging

Sequence:
>SY0AAB35YG02FM1
TTGGCGTTACATCTGTCCCACCCCTCCAACACCAACCATTTGACAAGCAA
TGGATTCCAACAACCCTCGCGAGACCTGGAACCGCATTCAAGCTGCCATT
ACTCGGGTCCAAAGACAGGGCGGCCCTGGCAGAGGACCGCCAAAGGGAGT
TTTGGGCGGTGGTGCTGCATTAGTACTGCTTGGTGCTGCAGCGGTTACCT
TTAACAGTGCAATTTTTAACGGTTTGCTTTTTTTTTTTTTCACCCTCATC
TTCTTGCATAGGGAATTAGACTGACGGTTTGTAGTTGATGGTGGTCATCG
TGCCATCAAATATACCCGCCTCGGGGGTGTCAAGAAGGAGATCTACAATG
AAGGAACACATTTTGTTATACCTTGGTTCGAGACACCAATTACTTACGAT
GTCCGTGCGAAGCCGAGAAATGTTGCTTCGTTGACTGGTACCAAAGATCT
CCAGATGGTCAATATCACTTGTCGTGTGCTTTCTCGTCCTCATGTTGATG
CCCTCCCGACAATTTACCGTACCCTTGGTGTGGACTATGATGAGCGTGTG
TTACCGTCGATTGTCAATGAGGTTTTGAA

Sequences in the Contig:

SY0AAB35YG02FM1