Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB35YF20FM1
Length(NT) : 607
Best Gene Model Blast : Link to GSTUMT00005397001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_02086
Accession: ref|XP_001559422.1| Score: 135 E_value: 3e-15
KEGG Definition: 60S ribosomal subunit biogenesis protein Nop16, putative
Accession: afm:AFUA_2G01480 Score: 113 E_value: 5e-12
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG4771 Score: 145 E_value: 2e-10
PFAM Definition: Nop16, Ribosome biogenesis protein Nop16. Nop16 is a protein involved in ribosome biogenesis..
Pfam Number: pfam09420 Score: 125 E_value: 4e-08
Swissprot: A6RNR4|NOP16_BOTFB

Sequence:
>SY0AAB35YF20FM1
TTGGATTTACCACCACAAACAATTCCGAACACCCCCCCGCCTCCACAAAA
ATGGGCCGCCAACTCCAAAAGAAGAAAAACAGAAGCTCAATACCGAAGCA
ATCCAAGCACAAAAACCCTCGCATCTTCAAGGTCCATCCAACCGGGAACG
CCCTCATAGCTGCAAACTGGTTCGCTCCGCTCCCACCTCCACCCACACTT
CCGAGTTGGCCGACTAGCTAACGAAGTGGTGGTGTAGGGATCGTAAGCAA
ACGCTCTCGCAGAATTACCGAAGATTGGGATTAGTTTCTAGGCTGGGGAA
GGCTACTGGGGGTGTTGAGAAGGGTTTCGCTTCTTCTGCTGCTGCCCAGC
AGCAGCAGAAGGAAAGGGTGAAGAAGCTGGCGCCCGGCGAAGCGCGTATC
GTCCGTGATGAGGAGGGGAATGTTATTCAAGTCATTTACGGCAAGTCTGC
TGAGGAGGCGCTGGACTCCGACTCTGAAGAGTTCACGGGGTGTGCTGGAG
GGGGTGGTGAAGAAATGGATTTTGTCAAAAAGTTGGAAGCCCAGGCTACC
GTCGGCGAGAGGAAGAGTAGGAAGATTTTGTGCCCTGGGGAGATGGATTG
GATTTCC

Sequences in the Contig:

SY0AAB35YF20FM1