Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB35YF06FM1
Length(NT) : 634
Best Gene Model Blast : Link to GSTUMT00009926001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_12133
Accession: ref|XP_001549405.1| Score: 162 E_value: 8e-10
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Transcription].
Kog Number: KOG4274 Score: 183 E_value: 1e-14
PFAM Definition: GAL11, Transcription regulatory protein GAL11. This family contains yeast GAL11 proteins. Gal11 and Sin4 proteins are yeast global transcription factors that regulate transcription of a variety of genes, both positively and negatively. Gal11, in a major part, functions in the activation of transcription, whereas Sin4 has an opposite role, yet they are reported to be present as a complex in the so-called RNA polymerase II holoenzyme..
Pfam Number: pfam05397 Score: 158 E_value: 8e-12

Sequence:
>SY0AAB35YF06FM1
TTGGCCGACACAACCACCGGTCCCGCAGCAGAATCCATATCTGCAGCAGC
AGCAGGCTCAACAACAGCAGCAAGCGCAATTACGACAACAGCAGTTACAG
CAGCAGCAGCAAGCTCAACAACAGATCCAGCAACAAACTCAGCAACAAGC
CCAGGCTCAGACACGAACCCAGATCCAAGTCCAATTACAACAGCAACAGG
CCCTCTACGGCTCACAGCAGCAGTGGTCACCTGCTCCCGCCACGCTTTCG
TACCCCCAACAACTTCAAATGAACCCGTACCAATCTAACCTCCAAGCACA
ACAACCACCAATCCCTCAGCGTGTTGGCATTGATAAATCTTCAATTTTGG
CGCTATACAACTATCCTCATCTGGCTCCTCCGCCTAATAATAATCCCGCC
CAACAACAGCAGCAGGAAAGCCAGGTGCCTGTTTCTAACGCTCCCCAGAG
CCTGGCTACCACGTTCGCCAACGGGGGGGCAGCCCCAGCACCAGTGACCC
ACGGAGCGGGTAGTAACAACCCGTTCCTCCCATCTGCCCCTCCAGTGGGT
GCTGGCGGCGGTCGAGGTCACATGAGTCAGGAAAGTGTGGATTTTGGAGC
ATGGCAGAGTGGGCGACACAGCCCCGACGCTTTT

Sequences in the Contig:

SY0AAB35YF06FM1