Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB35YE10FM1
Length(NT) : 557
Best Gene Model Blast : Link to GSTUMT00003034001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_06715
Accession: ref|XP_001797078.1| Score: 282 E_value: 7e-24
KEGG Definition: hypothetical protein
Accession: fgr:FG06663.1 Score: 251 E_value: 1e-20
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB35YE10FM1
TTGGCGGGGATGAGATCCGAGGTTCCTCAACAAAAGTGAACATGACCTCC
CAGGACACGACCGACGGCACTCAAGCTGAGAAACTCAAAAAACGCAAAAC
TCCAACAGCCCAGATCAAATATGACGATTGGCATACCCACCGCATGGATT
GGGTACATGGCGAGTCATCCTGGTTCGTGGACGGCGAGCATTTCCTTGAT
AAGAAATATGGTGTTCCAACCGTTGCTTCCAGCTTTATTATGAATTTGTG
GTCTGATGGTGGTGTCTGGTCCGGAAACATGACAAAGGGAAAGTCTGCTT
ATGCGGAGATTGAATTCGTAGAGATGGCGTTCAACACTACCGGGGATGAC
CGCGGCTCCGCGAACAGCAAAGTGAGGAGGGCTACAAGGAATAAGTGTGA
TAGGATCTGTGTGATCGATGATGTGGCTGTCGTTGGAACACCAGAAGGTG
CAAAGGGTGGGGCTTTCAAGAAGGCCGTCAATCCATGGTCTTTGGGTGTG
GCTATGTTGGTCGCCGGCGTATTGTCCTTTTAGGACGAGACTGCGGGTAC
ACCGTTG

Sequences in the Contig:

SY0AAB35YE10FM1