Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB35YC05FM1
Length(NT) : 628
Best Gene Model Blast : Link to GSTUMT00004368001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: rho guanidine dissociation inhibitor
Accession: gb|ABW17274.1| Score: 452 E_value: 2e-43
KEGG Definition: rho-gdp dissociation inhibitor
Accession: afm:AFUA_5G11380 Score: 314 E_value: 1e-27
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG3205 Score: 310 E_value: 2e-29
PFAM Definition: Rho_GDI, RHO protein GDP dissociation inhibitor..
Pfam Number: pfam02115 Score: 184 E_value: 8e-15
Swissprot: O14224|GDIR_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAB35YC05FM1
TTGGGGAAAGAAAAAAAAAAAATACCCCACACAAAGTATCCCGAAGCGCG
ACGATAAAAATTTCTCACATCCAACGCAATGGCTTCTCACGCAGATGACG
AGCTGAAGCCATCCACCACCGAAGGGTAAGTAATCTGGTTTGCTTCGGAT
TTTTCTCCTGGTGGGCCTGGTGATCCTTTCCCCGCACCTCGGTCTGCGGG
GTTTGGTGCTTCACGTCGCAAACGCACATGATTTCACGAAGATTAGAGCA
GGAAAATATTAACAGATATGCCGTAATACAGGTACAAGGTGGGGGAAAAG
AAGTCAGTTGATGAGTACGCAAAGCTAGATGCTGAGGATGAGTCTCTCGC
CCGCTGGAAGCAGTCTCTGGGTATTGGTTCTGGTAGTGCTGGAGGCTCTC
TTGGAGACCCTGGTGATAAGCGAAAGGTCGTTATTCTCCAACTCTGCCTA
TTGATCAGCGGTCGTCCAGATGTTGTCATCAGTCTCGATACCCCCGCAGC
TCTAGAAGAACTGGGGAACAAGCCTTTTATTATTAAGGAAGGTGCTGAAT
ACCGGATGAAGGTCAGATTCCGGGTTCAGCACGAGGTTATCTCCGGATTG
AGATATCTGCAGCTTGTGAAGAGGAAGG

Sequences in the Contig:

SY0AAB35YC05FM1