Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB34YO24FM1
Length(NT) : 468
Best Gene Model Blast : Link to GSTUMT00001458001 E-value : 2e-98
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein DEHA0B07964g
Accession: ref|XP_457301.1| Score: 141 E_value: 6e-14
KEGG Definition: hypothetical protein [EC:1.-.-.-]; K05545 tRNA-dihydrouridine synthase 4
Accession: dha:DEHA0B07964g Score: 141 E_value: 3e-14
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG2335 Score: 152 E_value: 2e-11
PFAM Definition: No Hit Found
Swissprot: O74553|DUS4_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>SY0AAB34YO24FM1
TTGGCATCAACGCCACCAACCCCCCGAGCCGATCCAAATGACAATGGATG
AAGAGAGTGAGATACCTGCCAGGGAAGTGGTGCATTATCCATTAAAGTTG
TTCGACCTTGCAAAGAGCGCAGGGAGGGTGTTGTATGTGCAAGCTCCGAT
GGTTAGGTATAGCAAACTCCCTTTTCGGGCTCTAGTGAGGGATTATGGGG
TTGATTTATGTTATACCCCTATGTGTCCTAGATTCTCGCGAAAGAATTTG
TCAGGAATCAGGCAGCTCGACTTAGCGGTAATTTATCCACACCCCCTATC
ACTCATCACCCCCCCCTTTCCCATATTCACCGCACTGAGATTGCATCTGC
TAAAAAGCTTCTACTAGATTTCACAACAAATGCATCAGACCGTCCCTTAA
TTGCCCAATTCGGGGCCCACTCCTCTATAGATTTTTCCCGAGCCGCTGAA
TTGGTAAAGCCGTACACG

Sequences in the Contig:

SY0AAB34YO24FM1