Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB34YO22FM1
Length(NT) : 590
Best Gene Model Blast : Link to GSTUMT00002767001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001543333.1| Score: 562 E_value: 3e-56
KEGG Definition: hypothetical protein
Accession: ani:AN8457.2 Score: 487 E_value: 7e-48
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1840 Score: 252 E_value: 8e-23
PFAM Definition: No Hit Found
Swissprot: P46825|KLC_LOLPE

Sequence:
>SY0AAB34YO22FM1
TTGGGAGAAAACTCTCGGGCCAGTTCATCAAGATACCTTACGGAGCGTTG
GTGATCTCGGTACGACTCTGCATAGGCAAGGAAAGCACGACGAGGCAGAG
ATTATGCATCGGCGTGCATTGGCGGGCAGAGAGAAAACACTTGGACTAGA
TCATCAAGATACCTTACGGAGTGTTAGTAATCTTGGCACGACTCTGCATA
GGCAGGGAAAGCACGATGAGGCAGAGATTATGCATCGACGTGCATTGGCG
GGCAGGGAGAGAACGTTTGGGCTAGATCATCAAGATACCTTACGCAATGT
TAATAATCTCGGTACCACTTTACATGAGCAAGGAAAGCACGCCGAGGCGG
AGATTATACATCGACGTGCATTGGCGGGCAGAGAGAAAACGCTCGGACGA
GATCATCGAGATACCTTAGAGAGCGTTAATAATGTCGGCATGACCCTGCG
TAGTCAAGGAAGGTACAACGAAGCCGAGATTATGTACCTACGTGCATTGG
CAGGTAGAGAGAAAACACTCGGGCTAGTTCATCGAGATACCTTACAGAGT
GTTAGGGATCTAGGAGTGGCGCTTTATAGGCAGGAAAAGT

Sequences in the Contig:

SY0AAB34YO22FM1