Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB34YO21FM1
Length(NT) : 580
Best Gene Model Blast : Link to GSTUMT00002981001 E-value : 1e-140
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001210912.1| Score: 279 E_value: 1e-32
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_1G15260 Score: 246 E_value: 1e-26
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB34YO21FM1
TTGGGGGGAAAAAAAAACTACAGAAGAAATACCGAATGTCTAGCAAGCCG
ATTTTCCTTGCAACTCATCCGAGGTCGTGTTCGACGGCTTTCGAAAGGGT
TATGATGACTAGGGAGGACTTGAGGTGTGTACATGAGCCGTTTGGCGATG
CTTTCTACTTCGGCGGAGAGAGGATTGGTGAGAGGTATTTTGGGAAAGAA
CACCAAGGTGTCAGGGACAAAAGCGGATTTTCCGAAACTACTTACCGAGA
CGTGGTCAGCAACATTAGCGGTGGGGGAGAAGATGTTTGCATCTCCTGCG
GAAAGCACTGGGATACTGTGCTAATCGAGTCTAGGGGAAAAGAGTCTTCT
TGAAAGATATGGCCTACTATATCATCCCTTACGATTCATCTGCTGGAATT
GGGGGAATCGCTCCCTCGCTTCGATTGGGAATCCACGAGGGGGAGGGATG
TGACACCAATGGGCGTTCTAATGATGCTTCTAATGAGAGTACCGACGGAA
TTAGGGATGTCTCTCCGGAAGATAACGACAATCCATCCGTTATCCCTCTT
TCAACCTTGAAGAACTACCATTTCAACTTT

Sequences in the Contig:

SY0AAB34YO21FM1