Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB34YO06FM1
Length(NT) : 492
Best Gene Model Blast : Link to GSTUMT00001152001 E-value : 3e-57
Numbers of ESTs : 1

Blast Results:

Nr Definition: Dicer-like protein 2
Accession: sp|Q0CEI2|DCL2_ASPTN Score: 193 E_value: 1e-13
KEGG Definition: hypothetical protein
Accession: ang:An14g03000 Score: 192 E_value: 7e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q0CEI2|DCL2_ASPTN

Sequence:
>SY0AAB34YO06FM1
TTGGCCGGATCATGCAGGAGTTCTACCACCCTCGAGTACGCAAGGGATTG
GAAGTTCCAGCTGTTCTTGGACTCACAGCTAGTCCAGTTGTGAAGTCGAC
CCCGGATCAGCTACGAGTGATTGAGACCAACCTGAACGCAATATCTCGGA
CACCGGTACGGAATCGTGAAGAATTGCTACGACATGTTCACCCACCGGTA
CTGAAGAGAATTGTTTATAAGTCGTCGTTTCAAGAATATGAACTTATTGA
CCCATCCTTTCTGGAGGATCTCCCCGATCAGGTTAACGAAAACAAAAAGA
GGAAGTTTTCAGAGACGATGTGGCCAGAGGCAATTGATCCCATGGGCTTA
TCAGAAAAAGGAGTCGAGATCCCGGCTAAAGATATTGCACCCCAGGAGAA
GATTCTCGTGCCTGAAATCAGCAATTTTAAGTCCCAGACGACGTCAAAGC
TCCCTGCTGCGGACAGCACTCCGTCTAGTGGGATGAAGACTC

Sequences in the Contig:

SY0AAB34YO06FM1