Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB34YN11FM1
Length(NT) : 528
Best Gene Model Blast : Link to GSTUMT00005351001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein TVAG_078320
Accession: ref|XP_001303050.1| Score: 229 E_value: 9e-18
KEGG Definition: hypothetical protein
Accession: tva:TVAG_078320 Score: 229 E_value: 5e-18
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 182 E_value: 9e-15
PFAM Definition: No Hit Found
Swissprot: Q9ERK0|RIPK4_MOUSE

Sequence:
>SY0AAB34YN11FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCCGCGGTGAACACTCGGGATTCGGATAGGCGCACGCCGCTGTC
CATCGTCACAAGGATGGGGAGACTGGGAGCTCTAAAAATGTTGCTGGAAA
GGCCGGACACCGATGTGAACGTCGAGGACCAAAAGCGAGAGTCTCCCATC
CGGCACCTGGTCCGCAAGGGCGACGAGGCCACGCTTAGAGCTCTCCTGCA
GAATAAGCGAGTTGACGTCAACTGTCCGTCCAAGAGTGGGTGGACGCCCA
TTCACGACGCCGTCAGTAGAAACCTCCGCGTGGTTCTGCGCATCCTAATC
CAAGACCCGAGGGTCGATGTCAATTGCGTTGGCCCGAGCGGCTGGACTGC
GCTGCATTTGGCGATCGGAATGCGCAATGAGAAGGCTTTCCGCATGATTC
TAGAGCATCCCGGCATTGATGTTAACGCTCAGGACTCAATTGGGTCCACT
CCCCTACATGCCGCTGTGCGCTGGGGGG

Sequences in the Contig:

SY0AAB34YN11FM1