Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB34YN08FM1
Length(NT) : 484
Best Gene Model Blast : Link to GSTUMT00004489001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_07905
Accession: ref|XP_001553496.1| Score: 639 E_value: 2e-65
KEGG Definition: hypothetical protein
Accession: fgr:FG02783.1 Score: 611 E_value: 2e-62
KOG Definition:
Classification: [Lipid transport and metabolism, General function prediction only].
Kog Number: KOG1269 Score: 342 E_value: 2e-33
PFAM Definition: Sterol_MT_C, Sterol methyltransferase C-terminal. This domain is found to the C-terminus of a methyltransferase domain (pfam08241) in fungal and plant sterol methyltransferases..
Pfam Number: pfam08498 Score: 287 E_value: 5e-27
Swissprot: Q9P3R1|ERG6_NEUCR
Gene Ontology:
GO:0003838 = Molecular function: sterol 24-C-methyltransferase activity

Sequence:
>SY0AAB34YN08FM1
TTGGAATGATTACCAGATCGATAGAGCTACACAGTACGCAGCAAAAGCTG
GATTGTCCCACAAATTGGACTTTGTCAAAGGAGACTTTATGCAAATGTCT
TTTGAACCTGGAACCTTTGATGCCGTATACGCCATTGAGGCCACCGTACA
TGCTCCTAGTCTTGAGGGTGTCTATTCTCAAATTTTCAAAGTGTTGAAGC
CTGGCGGTGTTTTTGGAGTGTATGAATGGCTCATGACCGACAATTATGAT
GCTTCCAACGCCAAGCACCGCGAGGTTTGCCACGGCATTGAAGTCGGCGA
TGGTATTTCACAGATGGTCAGGATCTCAGAAGCTCTGTGCGCCATCAAAG
CAGCGGGTTTTGAGCTTGAATTCCATGAGGACCTTGCCCAGAGAGATGAT
GCCATCCCCTGGTACTACCCGATTGCCGGCGAAATGAAGTATGTCCGTAG
CCTCGGAGACTTCTTCACTGTCCTCCGCATGACC

Sequences in the Contig:

SY0AAB34YN08FM1