Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB34YL16FM1
Length(NT) : 537
Best Gene Model Blast : Link to GSTUMT00003611001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB34YL16FM1
TTGGAGATTACAAGGCGCCTTTTAGAAGAAGGATTCATTGCACAAATTTC
TACTACCCGTACCGGGCGCCAAAAGAAAACCGTGAATGGGAGCCCCGTCA
AGTATCGGGTTGTCAAGACACCCGAGATGGCGAAGATAAAGGAAGTCCAA
TACTTTGATCCGCTAGTCAAGATATCCCACCACTTTGAAAACCCCAGCCC
TCCTGAGAACCTGCACAAGCCTGTTCTAAAAGACACTCCGGCCGTGAAGC
TTTCAGAACCTCCCGGATACGATGAAAGTGGGGTCGAAGATAGCCAAGCG
TTTGAGAGTCACTTCGAAGAGGCTATTGTGATTTCGGAATCAAACCACGG
GGTGGCCGGAGCGACCAGCAGATATGGACTCTACGGCTGACGAAGAGGAG
CTCCCGAGATCCAATGCATATCAAACCGAGCCAAATTCCACCATACCAGC
ACACGAAACTAGCAAGACAAGCAGTAGGGTTACATCCAGCTTTCCGCACA
AAAGCATTGGCCAAAGTTCGGCAACACCAGAGATGAT

Sequences in the Contig:

SY0AAB34YL16FM1