Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB34YL09FM1
Length(NT) : 453
Best Gene Model Blast : Link to GSTUMT00002097001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_06649
Accession: ref|XP_001242753.1| Score: 307 E_value: 6e-27
KEGG Definition: putative dehydrogenase [EC:1.1.1.-]; K00100
Accession: scl:sce3225 Score: 259 E_value: 1e-21
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG1205 Score: 248 E_value: 2e-22
PFAM Definition: adh_short, short chain dehydrogenase. This family contains a wide variety of dehydrogenases..
Pfam Number: pfam00106 Score: 161 E_value: 2e-12
Swissprot: O05730|VDLC_HELPY

Sequence:
>SY0AAB34YL09FM1
TTGGGCATCAGGGTTTACAGAGAAAATACTTTGAAATATTAGAAAAAGCC
TTTTTTCCGGAAACTTTCCAAGCTCAAAATGTCTGCTCAACAACGTGTCT
GGCTCGTCACCGGTACCACCTCTGGTATTGGTGAGAACATCGCCTTGGAG
GCCCTCTCACGCGGCGACCTAGTCGTAGCTAGCTCTCGCAACCCTTCCCG
CTTGACCAAACTTACAAAGGCCGGAGCCAAGGCCGTCAAGATAGACCAGA
ACCAGGACGACGCTACGATCCGAAAAGAAGTCGAGGCTGCCCTCGCGGTT
TACGGCCGAATCGATATCCTGGTGAACAACGCGGCATACGTGCACACCGG
AACCATCGAGGAGACAACCGACCAAGAAATCAAAAGCCAATTCCAAGCAA
ACGTCTTCGGCCCCACCTCCATCATCCGCGCCCTCCTTCCGCATATGCGC
GCT

Sequences in the Contig:

SY0AAB34YL09FM1