Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB34YK01FM1
Length(NT) : 312
Best Gene Model Blast : Link to GSTUMT00000086001 E-value : 1e-175
Numbers of ESTs : 1

Blast Results:

Nr Definition: WD-40 repeat-containing protein
Accession: gb|EDR14389.1| Score: 355 E_value: 2e-32
KEGG Definition: Phospholipase A-2-activating protein
Accession: cne:CNL05350 Score: 354 E_value: 1e-32
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG0301 Score: 336 E_value: 4e-33
PFAM Definition: PFU, PFU (PLAA family ubiquitin binding). This domain is found N terminal to pfam08324 and binds to ubiquitin..
Pfam Number: pfam09070 Score: 386 E_value: 7e-39
Swissprot: O94289|LUB1_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding
GO:0016574 = Biological process: histone ubiquitination
GO:0043161 = Biological process: proteasomal ubiquitin-dependent protein catabolic process
GO:0006950 = Biological process: response to stress

Sequence:
>SY0AAB34YK01FM1
TTGGGGCCAGGTGCTTATGGTGCGCAATGGGGAGACCGTAGAAGCCCATG
TTTGGTCCAATGCGGCAAGAGCGTGGAACAACGTCGGCACGGTTGTAGAT
GCTGTAGGTTCCAGTCGTAAGCAAATGTTTGAGGGTAAGGAGTACGACTA
CGTGTTTGATGTCGATATTCAAGAGGGGGCTCCTGCATTAAAGCTGCCGT
ATAATGCATCTGAAAACCCATTTGAGGCCGCTAGAAGGTTCCTTGAGGCG
AACGAATTGCCAATATCATATCTTGATACTGTTGGTCAATTTATCGTGAA
AAATGCTGGTGG

Sequences in the Contig:

SY0AAB34YK01FM1