Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB34YI17FM1
Length(NT) : 546
Best Gene Model Blast : Link to GSTUMT00007106001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: proliferating cell nuclear antigen
Accession: ref|XP_001211779.1| Score: 685 E_value: 1e-70
KEGG Definition: DNA polymerase delta processivity factor (proliferating cell nuclear antigen); K04802 proliferating cell nuclear antigen
Accession: aor:AO090003000846 Score: 681 E_value: 2e-70
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG1636 Score: 654 E_value: 2e-69
PFAM Definition: PCNA_C, Proliferating cell nuclear antigen, C-terminal domain. N-terminal and C-terminal domains of PCNA are topologically identical. Three PCNA molecules are tightly associated to form a closed ring encircling duplex DNA..
Pfam Number: pfam02747 Score: 463 E_value: 2e-47
Swissprot: Q03392|PCNA_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0043626 = Cellular component: PCNA complex
GO:0005657 = Cellular component: replication fork
GO:0005515 = Molecular function: protein binding
GO:0006271 = Biological process: DNA strand elongation during DNA replication
GO:0006301 = Biological process: postreplication repair
GO:0051726 = Biological process: regulation of cell cycle
GO:0010212 = Biological process: response to ionizing radiation
GO:0009411 = Biological process: response to UV

Sequence:
>SY0AAB34YI17FM1
TTGGCTCACATCTCTTACAAAGGTCCTCCGCTTTGCCCAAAACGAGGACA
TCTTGACTTTGAAGGCGGAAGATGCCCCGGACACCTTGAGTCTTGTCTTT
GAGAATGCCGAAAACGATCGTATTAGCGAGTATGAGATCAAATTGATGGA
TATCGATCAGGAACATCTAGGAATTCCCGAAACTGAGTATGCAGCGGCAA
TCTCAATGCCGAGTGCTGAGTTTCAGAGAATCTGCAGAGATCTGAATCAG
TTGTCTGAGTCTGTCGCCATTGAAGCTTCTAAGGAAGGTGTCAAATTCTC
CTGCAGTGGTGACATCGGAAGCGGATCTGTCACCCTTCGCCAGCACAATA
ATGTCGATAGACCAGAACTATCCACCAAAATCGAGCTTACCGAGCCAGTT
GCACTCACCTTCTCTCTGAAATACCTTGTCAACTTCTGCAAAGCGAGTGC
TTTATCTTCCGTTGTTACTCTTTCACTCTCTAACGAGGTACCCCTATTGG
TTGAGTATGCAATGGGCAGTGGCTTCGTCCGGTTCTATCTTGCCCC

Sequences in the Contig:

SY0AAB34YI17FM1