Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB34YI04FM1
Length(NT) : 537
Best Gene Model Blast : Link to GSTUMT00009792001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN6303.2
Accession: ref|XP_663907.1| Score: 450 E_value: 2e-43
KEGG Definition: hypothetical protein
Accession: ani:AN6303.2 Score: 450 E_value: 1e-43
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG1968 Score: 279 E_value: 5e-26
PFAM Definition: No Hit Found
Swissprot: O60182|RFC1_SCHPO
Gene Ontology:
GO:0031390 = Cellular component: Ctf18 RFC-like complex
GO:0005663 = Cellular component: DNA replication factor C complex
GO:0031391 = Cellular component: Elg1 RFC-like complex
GO:0000790 = Cellular component: nuclear chromatin
GO:0031389 = Cellular component: Rad17 RFC-like complex
GO:0005515 = Molecular function: protein binding
GO:0006260 = Biological process: DNA replication

Sequence:
>SY0AAB34YI04FM1
TTGGAAATTAAGACAATCAACGAGGATGGACTTTTCAAGCTTATTTCATC
TCTTCCCGCCAATGGCGGTGATGGACTCGCAGCAAGAGCCAACGAGGCCA
AGAAAGCGGCGGAGGAGCAGAAGGTTCGTGAACTGGCAAAGGAAATGGAT
GATGAAACCAAGAGTAGAGGAAAAGAAGCCATTGAGAAGGAGGCCACAGA
GCTCTGGACAGTCAAGTACGCGCCTTCGCAGTTGACCCAAATTTGCGGCA
ATAAGGGTCAGGTCGAAAAACTCGGGAGATGGTTAAGAAATTGGCCAAAG
AATCTTAAGACCGGTTTCAGGATGAGAGGTGCTGATGGGATGGGAGGTGC
CAGAGCTGTTATGATCCATGGGCCGCCGGGTATAGGGAAGACAACGGCTG
CTCATTTGGTGGCGAAGCTTGAAGGATACGATATCGTTGAGTCCAACGCT
AGTGATACTCGTAGTAAGAAGCTCATGGAGGAAAAACTTCGTGGTGTGCT
AGATAATAGATCCTTATTAGGGTATTTCGCTGGTGAC

Sequences in the Contig:

SY0AAB34YI04FM1