Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB34YG02FM1
Length(NT) : 483
Best Gene Model Blast : Link to GSTUMT00004950001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Putative protein of unknown function; protein is detected in purified mitochondria in high-throughput studies; null mutant displays decreased mitochondrial genome loss (petite formation) and severe growth defect in minimal glycerol media; Lrc2p
Accession: ref|NP_012179.1| Score: 131 E_value: 2e-06
KEGG Definition: Putative protein of unknown function; GFP-fusion protein is induced in response to the DNA-damaging agent MMS; the authentic, non-tagged protein is detected in highly purified mitochondria in high-throughput studies
Accession: sce:YIL087C Score: 131 E_value: 8e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P40502|YII7_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>SY0AAB34YG02FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGAAAAATTCATACCCTTTCA
CTACAGTCGCTTCATCAAATGTCCGGAGCAATAGCCCATCAAGCAAGACC
TTCCTCGATACGAGTGGCCGCCGGTACGCTGAGTCGCCACTGCCAGCATG
GGGCCTCCTCAATCGCAATCCTCTACCAACTCCCAGATTCCAAACGCCTC
TACAACAGCCGACTCCTCCCCCGACCGTGGACTGTCCTGCTATTCTCGTC
GCTATTCGCAGCCAGTGGCTGGATGGCGTACGATAACGCGCCGATCGATG
GCGCTGGCACCACCGCGGCCTGGTCGGCTATATATTGCATCATGAACGGG
AGCCCCCGAAAGCTTGGGAAGCTACTGCGATTCGGACGGGTCGCGCCGCT
CGGGACCGCGGGGTTTGTGGCGGCTAACACTATCACGCATGGGTATTACT
ATTTGACGGTACCGAGAAGTAAGGAAGAGGTTG

Sequences in the Contig:

SY0AAB34YG02FM1