Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB34YD17FM1
Length(NT) : 602
Best Gene Model Blast : Link to GSTUMT00007570001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_06998
Accession: ref|XP_001554410.1| Score: 307 E_value: 1e-26
KEGG Definition: ankyrin repeat
Accession: aor:AO090113000090 Score: 272 E_value: 7e-23
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB34YD17FM1
TTGGGCGATCTAGCAGGGCTATACACTAAGATTCTTGATAAAGCCGCATC
TCCCGATAAAGCGCGACGAATTTTGGAGATAGTGGTAGCTGCTGTCAGGC
CTCTCACACTTCGAGAAATGAACGTTGCATTCAGAATCAGGCGGGAGCAC
GACTCAATTGAGAACCCCTAGGGTCTTCCTGGCGGATTCGAGAAGACAGT
GAAAAATTTGTGCGGGCTTTTTGTTCGGGTTATTGATTCGAAAATCTACC
TTGTTCACCAAACTGCAAGGCAGTTCTTGATTCAGGGCTCCATTCCTGGC
CAGGGAAACTGGCAGTATACATTGTGCCCTAAGGATTCTAATTTCACTAT
TGCTGACATCTGTATTTCCTATCTTTCACTAGATGCATTTGCGGGAAGCG
CATTGGCGATAGATATTTGCGGTAGGGTTTCGGAGAACTCGGTTAACGAT
TATCTAAAGAAATACTCCTTCCTCGATTACGCAGTTCAGCACTGGGCAGA
TCACTTTCGAGATTCGCAGGATCGGGGGATGGGGTTATTCGAGTTTACGC
GACTGGTCTGTGGCTCGGGGCCCAAACACTGTCTGACATGGTTTCAAGTG
TA

Sequences in the Contig:

SY0AAB34YD17FM1