Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB34YD07FM1
Length(NT) : 428
Best Gene Model Blast : Link to GSTUMT00004427001 E-value : 1e-119
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE65164.1| Score: 305 E_value: 1e-26
KEGG Definition: biotin holocarboxylase synthetase/biotin-protein ligase [EC:6.3.4.- 6.3.4.10 6.3.4.11 6.3.4.15 6.3.4.9]; K01942 biotin-[methylmalonyl-CoA-carboxyltransferase] ligase; K01943 biotin--[propionyl-CoA-carboxylase (ATP-hydrolysing)] ligase; K01944 biotin-[meth
Accession: aor:AO090011000708 Score: 305 E_value: 5e-27
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG1536 Score: 147 E_value: 7e-11
PFAM Definition: No Hit Found
Swissprot: P48445|BPL1_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0004077 = Molecular function: biotin-[acetyl-CoA-carboxylase] ligase activity
GO:0004078 = Molecular function: biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity
GO:0004079 = Molecular function: biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity
GO:0004080 = Molecular function: biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity
GO:0009305 = Biological process: protein amino acid biotinylation

Sequence:
>SY0AAB34YD07FM1
TTGGGGGCTCATCATCCCCAACTTGCTCCCTAGGCGGGGTATCCTGCGGT
ACTCTACTGTTACTCGGCATCCGATCTATATTGTTCTGCGTTTGGTAGCT
TTGTCTACCCAGGGAGTCTCTAGAAGGAGCGTGAAAGCGAGAGGACTCTT
TTCAATCCATCGAGCACCCCAATTTTCGGCTCTTCGAATTTAAATCTACT
GATCGCTCTAAAAATGGGTCGAATGAATGTGCTGGTGTACTCCGGTACAG
GAACAACGGTTGAGTCAGTGAGACATTGTCTCTACTCCCTCCGCAGACTT
CTGTCACCCCACTACGCCGTCATCCCAGCAGCGGCCGACACGCTTCTCAA
AGAGCCGTGGGAAACATCTTGTGCACTCCTCATTATACCCGGCGGTGCAG
ACCTCGGGTACTGTCGAGTTCTTAATGG

Sequences in the Contig:

SY0AAB34YD07FM1