Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB34YC23FM1
Length(NT) : 573
Best Gene Model Blast : Link to GSTUMT00012052001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001537336.1| Score: 486 E_value: 2e-47
KEGG Definition: hypothetical protein
Accession: ncr:NCU07010.1 Score: 466 E_value: 2e-45
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1057 Score: 405 E_value: 1e-40
PFAM Definition: Acid_phosphat_A, Histidine acid phosphatase..
Pfam Number: pfam00328 Score: 123 E_value: 6e-08
Swissprot: O74429|VIP1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0030866 = Biological process: cortical actin cytoskeleton organization and biogenesis
GO:0030950 = Biological process: establishment and/or maintenance of actin cytoskeleton polarity

Sequence:
>SY0AAB34YC23FM1
TTGGCTTGATGATTCGAACGCTGCGAAGGACGAGATGGATAAGGTCAAGA
AGAAGTTGAAATCGCTGCTCCGTGAAGGCTCGAAACCCTCTCCGCAATTT
GCTTGGCCAAAAGATAATATGCCGGAACCTTCCGTAGTGATGCAAAATGT
TGTATCTTTGATGAAGTTCCATAGAAGAGTGATGCATCAAAACTACAGTA
GGCTTTTTGGCACTGGCGCATCTTCAACATCTTTGCCGTCCCTCGCTCTC
TCGGGCGCACCATTTCTCGCTCAGTCTACCGCCAATATTCAATCACGCTG
GTGCTGTGGTGAGGATCCTGAGCTTTTCAAAGAACGCTGGGAGAAGTTAT
TCGTCGAGTTCTGCGAGTGGGAGAAGGTCGACCCTAGCAAAATCTCAGAG
CTTTACGATACAATGAAATACGACGCACTGCATAACCGTCAATTTCTAGA
GGCGATTTTCATGCCTTCTGCCGCAATGTTGGAGGCTGATGACATGGACA
CCGCCGTCCTCGACTCGATGGAGGATTTGAATCCGCCTACTTCGGGAGAC
GTTAGGAAGTATTCCTTTTCTCC

Sequences in the Contig:

SY0AAB34YC23FM1