Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB34YB08FM1
Length(NT) : 441
Best Gene Model Blast : Link to GSTUMT00002414001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_00016
Accession: ref|XP_001597930.1| Score: 272 E_value: 7e-23
KEGG Definition: zgc:91991; zgc:91991 [EC:3.1.3.77]; K09880 acireductone synthase
Accession: dre:431773 Score: 262 E_value: 5e-22
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG2630 Score: 382 E_value: 4e-38
PFAM Definition: No Hit Found
Swissprot: Q6GMI7|ENOPH_DANRE
Gene Ontology:
GO:0043874 = Molecular function: acireductone synthase activity

Sequence:
>SY0AAB34YB08FM1
TTGGATTATGTACAAGCACAGACAATCCAGGATTCCAAATCCCCCGCTTT
AAAGGCCCTCCAGGGCCACCTCTGGCGGGCCGGGTACGAGTCCGGAGAAC
TCGTCGCCCCGATTTACCCCGATGTGCTCCCGGCTGTACGCGCATGGCGC
TCGCAGACTCCCCGTGCTGTGAGGGTGTACGTGTATTCCAGCGGGAGTGT
TAGGGCCCAAGAGTTGTTTTTTCACTACTCGTGCGAGGGGGATGTTAGGG
GGTTATTCGATGGGTTTTTCGATACGAGGGTTGGCGCGAAGGTTGAGGCG
GAGAGTTATCGGAAGATTCTTAGAGAGTGTGAAGAGGGGGGGGAGGGGGA
GGGCTGGGTCTTTTTGAGTGATCATGTTGGGGAGGTTAGGGCTGCTATGG
AGGCTGGGATGATTGGTGGGGTTGTCGTGCGTGAGGGGAAT

Sequences in the Contig:

SY0AAB34YB08FM1