Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB34YA24FM1
Length(NT) : 539
Best Gene Model Blast : Link to GSTUMT00005277001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU09098
Accession: ref|XP_964915.2| Score: 351 E_value: 7e-32
KEGG Definition: hypothetical protein
Accession: ncr:NCU09098.1 Score: 351 E_value: 3e-32
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2615 Score: 232 E_value: 1e-20
PFAM Definition: MFS_1, Major Facilitator Superfamily..
Pfam Number: pfam07690 Score: 161 E_value: 2e-12

Sequence:
>SY0AAB34YA24FM1
TTGGGCCTGATATTTCATTTCTTCATACTCGAGCACTTCCTCACCTTGTC
ACCCTTATCCTGCATTGCATAGGCCGTTCGATTTTCCAGCTCTAGCTATG
GCGCCGCCGACACCCGCGTACGCAAAGTCGATCATCAAAATCCTCTTCAT
CTCATTAATATTCGATTTGCTTTCGTTTACTTTAATTTTACCTTTATTCC
CCAGACTGCTCGCCTTCTACCGTGCGCAGCCTGATAATGTAGTTCTCGAG
TCTATTTTCGCGACCCTAAATACTTTCAAAGCTTCATTCCACCGGCCAAT
CTCCTCCCGTTTTGATGTAGTCCTGCTTGGTGGGGCTCTCGGGTCTTTAT
TTTCATTTCTTCAGGCAATCTCTAGTCCATTCTTGGGTGCTCTCAGCGAC
CGCTATGGGCGCCGAACAGCTCTATTGTATTCCATGATTGGAAACATAGT
CTCCGTTCTACTTTGGGTCGTCGCAACTGATTTCCCGACATTCCTGGCTT
CTCGTGTAGTTGGTGGTCTATCGGAGGGAAATGTACAGC

Sequences in the Contig:

SY0AAB34YA24FM1