Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB34YA10FM1
Length(NT) : 505
Best Gene Model Blast : Link to GSTUMT00006682001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_06286
Accession: ref|XP_001796663.1| Score: 421 E_value: 4e-40
KEGG Definition: hypothetical protein
Accession: mgr:MGG_01543 Score: 386 E_value: 3e-36
KOG Definition:
Classification: [Chromatin structure and dynamics, Signal transduction mechanisms].
Kog Number: KOG2132 Score: 284 E_value: 1e-26
PFAM Definition: No Hit Found
Swissprot: Q1JP61|JMJD5_BOVIN

Sequence:
>SY0AAB34YA10FM1
TTGGCCAGAAATCACCCACCAGATCCCGATCCGACCAACCCCCCCATCCC
TCGGCTTCTTCCAGAACCACCTCGACACGGCAAATACCCCACTGCAGATC
CAAAACCTATTAACAGCCTGGCCAGCAGTGACCACAAACCCTTGGTCCTC
GCCCTCCTACCTCCTCTCAAAAACCCACTTCGGTACCCGCCTCGTGCCCA
TCGAACTGGGCAAGTCCTACACCATGGAGAACTGGTCGCAGAAGATCATG
CCATTCCGCGACTTCTTAAAGACCTACATCCTCTCCCCGGAGGCCGACAG
CTCGTCGTATCCGGGGTATCTAGCCCAGCACAGCCTATTCTCCCAAATCC
CTTCATTAAGGGAGGATATTTTAACGCCGGATTATTGCTATAGCACGCCA
CCACCTGCACCTCCTGGTGCACGTACGCATCCGCTTGAAGTCCCAATCGT
CAATGCTTGGTTCGGCCCCGCGGGGACGGTCTCGCCGTTGCATACGGACC
CCTAC

Sequences in the Contig:

SY0AAB34YA10FM1