Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB33YM04FM1
Length(NT) : 584
Best Gene Model Blast : Link to GSTUMT00007940001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein PGUG_00437
Accession: ref|XP_001487060.1| Score: 168 E_value: 4e-15
KEGG Definition: hypothetical protein [EC:1.14.99.29]; K06072 deoxyhypusine monooxygenase
Accession: mgr:MGG_01725 Score: 126 E_value: 1e-13
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0567 Score: 303 E_value: 9e-29
PFAM Definition: No Hit Found
Swissprot: Q1E9L2|DOHH_COCIM
Gene Ontology:
GO:0019135 = Molecular function: deoxyhypusine monooxygenase activity

Sequence:
>SY0AAB33YM04FM1
TTGGCTTCCAAATTCCCAGCAAACACCCCGGAAAGTAGCCCAAAGAATGG
CCACCGCAGACCCTGTCCCCGCCCTCCGCAAGGTCCTCGGTGATGACAAT
CAGGAAAATCTTGCCCTTCGATTCCGTGCCCTCTTTTCACTCAAGCACCT
CGCTCGCAACGGTAGCAAACCAGCGATAGAAGCAATCGCAAACGCCTTCA
GCAGCAAATCCGTTTCTACAGTCCATCTTAGACACCAAATCCGAAGACCC
AATGGTCCGCCATGAGGCAGCTGAAGCCCTGGGTGCCCTCGCACATGCTG
AGTCACTCCCACTACTGGAAAAATACTTGAACGATCCGGAGGAGGTAGTA
CGGCAGACTTGCGAACTTTCAATCGCAAGAATTAACTGGTTATCTTCGCA
GAAGGACGGGGAGGGAGGTAGCAAGGACGGCAGTGGTCAGGAAGGGGGTT
TATTTGCGGGAGTGGTCGATCCAGCGCCACCAGCAGGGGGCGGTAACGTG
GAGGAATTGCAAAGGACATTGAACGACCAGGGGACGGACCTGTTCGAGCG
ATATAGAGTTATGTTCCGGTTGAGGGATATCGGG

Sequences in the Contig:

SY0AAB33YM04FM1